Diethyl pyrocarbonate: a chemical probe for secondary structure in negatively supercoiled DNA.
نویسنده
چکیده
Purine residues located within regions of DNA that have the potential to form left-handed Z-helical structures are modified preferentially by diethyl pyrocarbonate; this hyperreactivity is dependent on the degree of negative superhelicity of the circular DNA molecules. As negative superhelical density increases, guanosines in a 32-base-pair alternating G-C sequence and adenosines (but not guanosines) in a 64-base-pair alternating A-C/G-T sequence become 5- to 10-fold more reactive to diethyl pyrocarbonate. The negative superhelical densities at which enhanced reactivity occurs are similar to those reported for the point at which left-handed helices form within plasmids carrying these DNA sequences. Probing of negatively supercoiled pBR322 with diethyl pyrocarbonate reveals a hyperreactive region 31 base pairs in length of which only 9 base pairs are a perfect alternating purine and pyrimidine sequence; the reactivity of purines within this sequence indicates that purines in the anti conformation, or guanosines in the syn conformation with neighboring 3' thymidines, are not hyperreactive in the Z-DNA form.
منابع مشابه
Diethyl pyrocarbonate: a chemical probe for DNA cruciforms.
Two palindromic DNA sequences were analyzed with respect to their chemical reactivities with diethyl pyrocarbonate. In negatively supercoiled plasmid templates enhanced N7 carbethoxylation was found with individual purines located in presumptive single-stranded loops of DNA cruciform structures. No enhanced reactivity at these positions was observed in linear, relaxed or low superhelical densit...
متن کاملH-DNA and Z-DNA in the mouse c-Ki-ras promoter.
The mouse c-Ki-ras protooncogene promoter contains a homopurine-homopyrimidine domain that exhibits S1 nuclease sensitivity in vitro. We have studied the structure of this DNA region in a supercoiled state using a number of chemical probes for non-B DNA conformations including diethyl pyrocarbonate, osmium tetroxide, chloroacetaldehyde, and dimethyl sulfate. The results demonstrate that two typ...
متن کاملHoogsteen base pairs proximal and distal to echinomycin binding sites on DNA.
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quinoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical "footprinting" (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments...
متن کاملSequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures.
The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in n...
متن کاملLong (dA)n.(dT)n tracts can form intramolecular triplexes under superhelical stress.
Plasmids containing long tracts of (dA)n.(dT)n have been prepared and their conformations examined in linear and supercoiled DNA using a series of chemical and enzymic probes which are known to be sensitive to unusual DNA structures. Under superhelical stress and in the presence of magnesium the sequence T69.A69 adopts a conformation at pH 8.0 consistent with the formation of an intramolecular ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- Proceedings of the National Academy of Sciences of the United States of America
دوره 82 23 شماره
صفحات -
تاریخ انتشار 1985